Quick-ITS Plus NGS Library Prep Kit

The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode addition using specially designed primers. After pooling by equal volume, a single clean-up of the final library is performed, rather than massive AMPure® bead-based clean-ups. Additional library quantification analysis such as TapeStation® analysis or gel electrophoresis are not necessary. With these features, the workflow dramatically reduces the hands-on time of library preparation to only 30 minutes.

– The most streamlined NGS kit with only 30 minutes of hands-on time for 96 samples.
– 100% automation ready with only a single PCR step and without the need for normalization.
– Real-time PCR enables absolute microbial copy number quantification.

Amplicon SizeThe final amplicon size after 1-Step PCR (targeted amplification and barcode addition) is ~480 bp.
Barcode Sequences10 bp barcodes, Available for download here (USA Only), or under the Documents section as “Barcode Sequences”.
Index PrimersDual index (barcodes) to uniquely label samples.
ITS Primer Sequences(adapters not included)
ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp).
Required EquipmentMicrocentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates.
Sample InputPurified microbial DNA ≤100 ng, free of PCR inhibitors.
Sequencing PlatformIllumina MiSeq® without the need to add custom sequencing primers. Zymo Research recommends the MiSeq® Reagent Kit v3 (600-cycle). For assistance with sample sheet setup, see Appendix F.

Order information
Cat #NameSize
D6424-PS1Quick-ITS Plus NGS Library Prep Kit with Primer Set 196 rxns
D6426Quick-ITS Plus NGS Library Prep Kit24 rxns
D6424-PS2Quick-ITS Plus NGS Library Prep Kit with Primer Set 296 rxns
D6424-PS3Quick-ITS Plus NGS Library Prep Kit with Primer Set 396 rxns
D6424-PS4Quick-ITS Plus NGS Library Prep Kit with Primer Set 496 rxns
Sản phẩm liên quan​

Quick-16S Plus NGS Library Prep Kit (V4)

Overview The Quick-16S Plus NGS Library Prep Kit (V4) is the fastest and simplest NGS library prep targeting the V4 region of the 16S rRNA gene for high-throughput sequencing. The automation-friendly protocol utilizes a premixed amplification

Xem thêm »

Quick-ITS Plus NGS Library Prep Kit

Overview The Quick-ITS Plus NGS Library Prep Kit is the fastest and simplest NGS library prep targeting the ITS region for high-throughput sequencing. The automation-friendly protocol utilizes a single qPCR/PCR for combined targeted amplification and barcode

Xem thêm »